ID: 1150565275_1150565285

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1150565275 1150565285
Species Human (GRCh38) Human (GRCh38)
Location 17:66333592-66333614 17:66333610-66333632
Sequence CCTCTTATTCCCCATGCCCTGTG CTGTGCTTGTGAAGGGGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 295} {0: 1, 1: 0, 2: 3, 3: 18, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!