ID: 1150599648_1150599653

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1150599648 1150599653
Species Human (GRCh38) Human (GRCh38)
Location 17:66639686-66639708 17:66639699-66639721
Sequence CCTACCTTTATATATTAATAAAC ATTAATAAACAGAGGAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 421} {0: 1, 1: 0, 2: 4, 3: 56, 4: 522}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!