ID: 1150606647_1150606653

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1150606647 1150606653
Species Human (GRCh38) Human (GRCh38)
Location 17:66697310-66697332 17:66697351-66697373
Sequence CCATCATTCCCCTGTAGACGCAT ATGGACAAGAGTGTCTTTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 89} {0: 1, 1: 1, 2: 11, 3: 43, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!