ID: 1150612818_1150612833

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1150612818 1150612833
Species Human (GRCh38) Human (GRCh38)
Location 17:66747888-66747910 17:66747919-66747941
Sequence CCCCCCGAGTGCTGGGCACTGTT GGGGGTGCCGGGCCAGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 270} {0: 1, 1: 0, 2: 1, 3: 9, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!