ID: 1150612818_1150612839

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1150612818 1150612839
Species Human (GRCh38) Human (GRCh38)
Location 17:66747888-66747910 17:66747941-66747963
Sequence CCCCCCGAGTGCTGGGCACTGTT GAGCCCAGAGGAGAGCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 270} {0: 1, 1: 0, 2: 3, 3: 63, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!