ID: 1150612819_1150612833

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1150612819 1150612833
Species Human (GRCh38) Human (GRCh38)
Location 17:66747889-66747911 17:66747919-66747941
Sequence CCCCCGAGTGCTGGGCACTGTTC GGGGGTGCCGGGCCAGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 234} {0: 1, 1: 0, 2: 1, 3: 9, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!