ID: 1150612821_1150612837

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1150612821 1150612837
Species Human (GRCh38) Human (GRCh38)
Location 17:66747891-66747913 17:66747937-66747959
Sequence CCCGAGTGCTGGGCACTGTTCCA AGAGGAGCCCAGAGGAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 369} {0: 1, 1: 2, 2: 10, 3: 91, 4: 822}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!