ID: 1150612834_1150612843

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1150612834 1150612843
Species Human (GRCh38) Human (GRCh38)
Location 17:66747926-66747948 17:66747945-66747967
Sequence CCGGGCCAGAAAGAGGAGCCCAG CCAGAGGAGAGCTGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 32, 4: 394} {0: 1, 1: 0, 2: 2, 3: 88, 4: 767}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!