ID: 1150612836_1150612845

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1150612836 1150612845
Species Human (GRCh38) Human (GRCh38)
Location 17:66747931-66747953 17:66747952-66747974
Sequence CCAGAAAGAGGAGCCCAGAGGAG AGAGCTGGGAGGAGGGCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 318} {0: 1, 1: 0, 2: 4, 3: 45, 4: 512}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!