ID: 1150612836_1150612849

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1150612836 1150612849
Species Human (GRCh38) Human (GRCh38)
Location 17:66747931-66747953 17:66747967-66747989
Sequence CCAGAAAGAGGAGCCCAGAGGAG GCCTTGGGGCTGGAGGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 318} {0: 1, 1: 2, 2: 12, 3: 58, 4: 723}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!