ID: 1150617920_1150617924

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1150617920 1150617924
Species Human (GRCh38) Human (GRCh38)
Location 17:66786255-66786277 17:66786281-66786303
Sequence CCTTCCTCTCTCAGCCTGGTAAC AAACCCAGTCAAAGCGGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 309} {0: 1, 1: 0, 2: 0, 3: 2, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!