ID: 1150641524_1150641527

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1150641524 1150641527
Species Human (GRCh38) Human (GRCh38)
Location 17:66952973-66952995 17:66952986-66953008
Sequence CCAGGAACACACAGGGATGCACA GGGATGCACATGGCAGGAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 29, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!