ID: 1150643594_1150643604

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1150643594 1150643604
Species Human (GRCh38) Human (GRCh38)
Location 17:66965071-66965093 17:66965094-66965116
Sequence CCCCGCCGCGCCCGCGGCGACCT CACCCACTCTGGTCTGTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 259} {0: 1, 1: 0, 2: 2, 3: 18, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!