ID: 1150647163_1150647171

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1150647163 1150647171
Species Human (GRCh38) Human (GRCh38)
Location 17:66986148-66986170 17:66986168-66986190
Sequence CCTCTTATGAGAGGAGGCCAGAA GAAGCTGGGGACAGGGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150} {0: 1, 1: 0, 2: 14, 3: 93, 4: 988}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!