ID: 1150662125_1150662128

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1150662125 1150662128
Species Human (GRCh38) Human (GRCh38)
Location 17:67091891-67091913 17:67091918-67091940
Sequence CCCTCAAATTATCATTTTCTGCT GCAAATACGCTACAGTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 465} {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!