ID: 1150664941_1150664945

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1150664941 1150664945
Species Human (GRCh38) Human (GRCh38)
Location 17:67125600-67125622 17:67125636-67125658
Sequence CCAGGGACAACTGCTTAGCATGT CAATTTAATCAGAGTGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99} {0: 1, 1: 0, 2: 1, 3: 12, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!