ID: 1150694123_1150694124

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1150694123 1150694124
Species Human (GRCh38) Human (GRCh38)
Location 17:67389539-67389561 17:67389564-67389586
Sequence CCAGAGGACACTGGAGAGGTTTT TGCCATTTAAAAATAGATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 208} {0: 1, 1: 0, 2: 2, 3: 47, 4: 441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!