ID: 1150699294_1150699297

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1150699294 1150699297
Species Human (GRCh38) Human (GRCh38)
Location 17:67433704-67433726 17:67433728-67433750
Sequence CCATCTCTAAAAAATAGAAATAA AAAAAGAGGAAGCCAGGTGCAGG
Strand - +
Off-target summary {0: 2, 1: 67, 2: 1183, 3: 6488, 4: 124200} {0: 1, 1: 1, 2: 2, 3: 45, 4: 537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!