ID: 1150714904_1150714909

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1150714904 1150714909
Species Human (GRCh38) Human (GRCh38)
Location 17:67563852-67563874 17:67563874-67563896
Sequence CCAATGGTGGGGGAGATGTGGGG GAGAGAGAGAAATGGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 274} {0: 1, 1: 3, 2: 31, 3: 377, 4: 3003}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!