ID: 1150723018_1150723028

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1150723018 1150723028
Species Human (GRCh38) Human (GRCh38)
Location 17:67629386-67629408 17:67629424-67629446
Sequence CCTCAGGCTCCCAAGTAGCTGGG CAACATGCCCAGTAGGGACGGGG
Strand - +
Off-target summary {0: 821, 1: 95512, 2: 207388, 3: 248015, 4: 259548} {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!