ID: 1150735834_1150735835

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1150735834 1150735835
Species Human (GRCh38) Human (GRCh38)
Location 17:67738296-67738318 17:67738311-67738333
Sequence CCAGGACGAAACAAAGGAGAGCA GGAGAGCACTTCATGCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 127} {0: 1, 1: 0, 2: 2, 3: 16, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!