ID: 1150790854_1150790868

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1150790854 1150790868
Species Human (GRCh38) Human (GRCh38)
Location 17:68199341-68199363 17:68199390-68199412
Sequence CCGCGACCCAGCGCAGCAGCCTG CTTGCGGCCTGCGCAGTCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 8, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!