|
Left Crispr |
Right Crispr |
| Crispr ID |
1150818816 |
1150818823 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:68418095-68418117
|
17:68418146-68418168
|
| Sequence |
CCTTATGTGCCAGACTAGAAACT |
AATTGTAAGCTGGACATTGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 5, 3: 27, 4: 161} |
{0: 1, 1: 1, 2: 2, 3: 18, 4: 196} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|