ID: 1150823730_1150823740

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1150823730 1150823740
Species Human (GRCh38) Human (GRCh38)
Location 17:68457112-68457134 17:68457131-68457153
Sequence CCCAACCTTGTCGCTCTGGGAGG GAGGACACTGGGAGTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 113} {0: 1, 1: 0, 2: 3, 3: 80, 4: 646}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!