ID: 1150823733_1150823747

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1150823733 1150823747
Species Human (GRCh38) Human (GRCh38)
Location 17:68457117-68457139 17:68457144-68457166
Sequence CCTTGTCGCTCTGGGAGGACACT GTGGGGTGGGGTGGGGGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100} {0: 4, 1: 45, 2: 470, 3: 10262, 4: 27099}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!