ID: 1150868866_1150868868

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1150868866 1150868868
Species Human (GRCh38) Human (GRCh38)
Location 17:68882177-68882199 17:68882222-68882244
Sequence CCTACAAAGGCAGTTTTTTCAGG GCCTGTCCTTTCAGATCAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 203} {0: 1, 1: 0, 2: 0, 3: 21, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!