ID: 1150875063_1150875066

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1150875063 1150875066
Species Human (GRCh38) Human (GRCh38)
Location 17:68961748-68961770 17:68961773-68961795
Sequence CCTTAGCACTTCTCACCTGTAGC AAGAAATGTATGCTGCACCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!