ID: 1150917684_1150917688

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1150917684 1150917688
Species Human (GRCh38) Human (GRCh38)
Location 17:69453092-69453114 17:69453120-69453142
Sequence CCTGATGACGCAGAGCAGGAGTT GGAACAGGAGTGCAGATTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100} {0: 1, 1: 0, 2: 1, 3: 14, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!