ID: 1151096918_1151096926

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1151096918 1151096926
Species Human (GRCh38) Human (GRCh38)
Location 17:71509153-71509175 17:71509195-71509217
Sequence CCCCATCAACATCTCACCTTCCT CCGGCACCTGCACTTCTTTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!