ID: 1151099487_1151099500

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1151099487 1151099500
Species Human (GRCh38) Human (GRCh38)
Location 17:71540400-71540422 17:71540453-71540475
Sequence CCCACCTCGGCCTCCCAAAGTGC GCTGAATGAAGGGGTTTTAGAGG
Strand - +
Off-target summary {0: 36192, 1: 181118, 2: 265840, 3: 185597, 4: 116247} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!