ID: 1151099489_1151099497

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1151099489 1151099497
Species Human (GRCh38) Human (GRCh38)
Location 17:71540404-71540426 17:71540443-71540465
Sequence CCTCGGCCTCCCAAAGTGCTGAG ACTGCACCTGGCTGAATGAAGGG
Strand - +
Off-target summary {0: 5533, 1: 132266, 2: 273114, 3: 208814, 4: 126129} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!