ID: 1151165811_1151165816

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1151165811 1151165816
Species Human (GRCh38) Human (GRCh38)
Location 17:72202839-72202861 17:72202860-72202882
Sequence CCTCACTCCTGCTGCTGCTGCTG TGCTGGTGGTGCTCTCTGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 28, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!