ID: 1151205728_1151205733

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1151205728 1151205733
Species Human (GRCh38) Human (GRCh38)
Location 17:72505372-72505394 17:72505412-72505434
Sequence CCTGAGACTGGGTAATTTATAAA GAGGCACAATTCCATGTGGCTGG
Strand - +
Off-target summary {0: 6401, 1: 13084, 2: 14111, 3: 11019, 4: 7181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!