ID: 1151218244_1151218254

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1151218244 1151218254
Species Human (GRCh38) Human (GRCh38)
Location 17:72592372-72592394 17:72592392-72592414
Sequence CCTGTCCTCTGCGCTCCAGACTC CTCGCGGAGGTCGCGGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 365} {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!