ID: 1151226591_1151226594

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1151226591 1151226594
Species Human (GRCh38) Human (GRCh38)
Location 17:72652539-72652561 17:72652578-72652600
Sequence CCTGTCCTGGGGTGAGGGTGAGT CAGCGTGAAATAACAGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 350} {0: 1, 1: 0, 2: 2, 3: 45, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!