ID: 1151229912_1151229917

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1151229912 1151229917
Species Human (GRCh38) Human (GRCh38)
Location 17:72677158-72677180 17:72677178-72677200
Sequence CCTCTCTCAGAACCCATCACATC ATCCTAGCACTGTGGATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 241} {0: 1, 1: 0, 2: 2, 3: 49, 4: 878}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!