ID: 1151235736_1151235739

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1151235736 1151235739
Species Human (GRCh38) Human (GRCh38)
Location 17:72718571-72718593 17:72718612-72718634
Sequence CCTTGGGGTCACAGCCAGGCACG ATAATTAAGAGCACAGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 210} {0: 1, 1: 3, 2: 28, 3: 164, 4: 741}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!