ID: 1151249321_1151249328

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1151249321 1151249328
Species Human (GRCh38) Human (GRCh38)
Location 17:72821380-72821402 17:72821414-72821436
Sequence CCTGTAGTCCCAGCTACTCAGGA AAGAACCGATTGAACTCAGGAGG
Strand - +
Off-target summary {0: 40895, 1: 157395, 2: 217955, 3: 208005, 4: 130380} {0: 1, 1: 4, 2: 244, 3: 5946, 4: 46585}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!