|
Left Crispr |
Right Crispr |
Crispr ID |
1151249324 |
1151249332 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:72821388-72821410
|
17:72821426-72821448
|
Sequence |
CCCAGCTACTCAGGAGGCGGAGG |
AACTCAGGAGGCGGAGGTTGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 412, 1: 100196, 2: 206734, 3: 241376, 4: 154667} |
{0: 102, 1: 2486, 2: 8639, 3: 13723, 4: 16196} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|