ID: 1151265006_1151265014

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1151265006 1151265014
Species Human (GRCh38) Human (GRCh38)
Location 17:72948010-72948032 17:72948054-72948076
Sequence CCCAGTTGCCAGGCCATGCTGGG TTCCAGGTATAGGACTTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 220} {0: 1, 1: 0, 2: 1, 3: 6, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!