ID: 1151265251_1151265258

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1151265251 1151265258
Species Human (GRCh38) Human (GRCh38)
Location 17:72950295-72950317 17:72950336-72950358
Sequence CCCCTTTGGGTATCCACCTCTTC GCCCTGCAGTATCACGGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174} {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!