|
Left Crispr |
Right Crispr |
| Crispr ID |
1151270016 |
1151270022 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:72986773-72986795
|
17:72986826-72986848
|
| Sequence |
CCAAGCACTTTGGGAGGCTGAGG |
GACCAGCCTCGCCAACATGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 90349, 1: 212695, 2: 235979, 3: 260133, 4: 296590} |
{0: 2, 1: 70, 2: 982, 3: 1827, 4: 2190} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|