|
Left Crispr |
Right Crispr |
Crispr ID |
1151274655 |
1151274662 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:73024961-73024983
|
17:73025001-73025023
|
Sequence |
CCACCTCGGCCTCCCAAAATGCT |
CTACCGCGCCTGGCCAAAACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 3308, 1: 98747, 2: 190507, 3: 136049, 4: 84666} |
{0: 1, 1: 1, 2: 35, 3: 237, 4: 1060} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|