ID: 1151274862_1151274878

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1151274862 1151274878
Species Human (GRCh38) Human (GRCh38)
Location 17:73026772-73026794 17:73026820-73026842
Sequence CCTCCCCACCCTACCCATCAACC AACTGAAGGCGGGCCAGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 91, 4: 1315} {0: 1, 1: 0, 2: 4, 3: 102, 4: 647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!