ID: 1151287981_1151287992

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1151287981 1151287992
Species Human (GRCh38) Human (GRCh38)
Location 17:73127333-73127355 17:73127384-73127406
Sequence CCCCTCAAGGTCAAAGACAGAGG AGGCACGGCCCTCTCCACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!