ID: 1151294100_1151294105

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1151294100 1151294105
Species Human (GRCh38) Human (GRCh38)
Location 17:73171106-73171128 17:73171127-73171149
Sequence CCTTCTAGCCTCTGCCCTTGGGG GGATTTGCTTCATTAATTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 244} {0: 1, 1: 0, 2: 3, 3: 19, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!