ID: 1151294100_1151294110

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1151294100 1151294110
Species Human (GRCh38) Human (GRCh38)
Location 17:73171106-73171128 17:73171157-73171179
Sequence CCTTCTAGCCTCTGCCCTTGGGG GGTCAATGTAAGAAGGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 244} {0: 1, 1: 0, 2: 1, 3: 23, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!