ID: 1151298278_1151298282

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1151298278 1151298282
Species Human (GRCh38) Human (GRCh38)
Location 17:73201959-73201981 17:73201992-73202014
Sequence CCAACCTCAATCAGTTCCTTCAG AAAACAATTCTGATTTCATACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 189} {0: 1, 1: 1, 2: 5, 3: 77, 4: 691}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!