|
Left Crispr |
Right Crispr |
| Crispr ID |
1151300520 |
1151300525 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:73221628-73221650
|
17:73221643-73221665
|
| Sequence |
CCTGTAATCCTAATACTTTGGAA |
CTTTGGAAGGCCAAGGTGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 290, 2: 6616, 3: 71763, 4: 365108} |
{0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|