ID: 1151309875_1151309883

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1151309875 1151309883
Species Human (GRCh38) Human (GRCh38)
Location 17:73286406-73286428 17:73286438-73286460
Sequence CCCAGCGGGGCGCTGATCATCTC GTCCGCTCGGGAACGGCGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 46} {0: 1, 1: 0, 2: 0, 3: 2, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!